Genetic epigenetic question?

Posted on 2016-05-05 18:50:00 in Biology by ALIFA

Epigenetic modifications to DNA sequences and resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat it with sodium bisulfite. 

a)If your original DNA sequence is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and your sequence after treatment reads: ACAGTTCGTCGGAGCTTGTTAGTCGATCGCACTT, which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) 

b)When this DNA sequence is replicated, which of these methylations will be transferred to the new sequence? Indicate what the new sequence will be in the standard 5’ → 3’ direction. 

c)How does an increase in DNA methylation affect chromatin structure and what does this do to gene expression? Be specific. 

d)Describe how chromatin structure is altered in the process of X-inactivation and how the active X-chromosome prevents itself from being inactivated. Include the functions of Jpx, Xist, Tsix, and describe what each of these gene products do. Be specific.

---

Answer Comment

No Answers Posted Yet.